Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 4AL_7148983

[Submit comment/correction]

Sequence	IACX5828
Contig	4AL_7148983
Probe	IACX5828
DNA Homology	4AL_7148983 Best IWGSC match 158 2e-36 URGI_Best IWGSC_N
BLAST, e-value	2e-36 4AL_7148983 Best IWGSC match
DNA	gatctcgcaggaggagtacctcaacgcgccaggcgagacctactccgtca ccctcaccgtSccgggcacctacggcttctactgcgagccgcaccaagga gccggaatggtcggcaaggt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.