Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 4AL_7171326

[Submit comment/correction]

Sequence	BobWhite_s64797_152
Contig	4AL_7171326
Probe	BobWhite_s64797_152
DNA Homology	4AL_7171326 Best IWGSC match 145 1e-32 URGI_Best IWGSC_N
BLAST, e-value	1e-32 4AL_7171326 Best IWGSC match
DNA	cgccgcaggagagatcccactcagcctcggctccaatccgcgactcgact Mgaagctccagctccgccgccgcccccgccgtccgactaggtaggtaccc g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.