Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 4DL_14406617

[Submit comment/correction]

Sequence	tplb0036a20_1295
Contig	4DL_14406617
Probe	tplb0036a20_1295
DNA Homology	4DL_14406617 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 4DL_14406617 Best IWGSC match
DNA	cctcagcttcccgtcggcggtgacccacctctccggcctgaactccatgc Rgtccttgccccacacgccctccatcctcgccatgcagtaggagaagatg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.