Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-2566_418

[Submit comment/correction]

Sequence	GENE-2566_418
Contig	4BL_6913816
Probe	GENE-2566_418
DNA Homology	4BL_6913816 Best IWGSC match 148 9e-34 URGI_Best IWGSC_N
BLAST, e-value	9e-34 4BL_6913816 Best IWGSC match
DNA	cctgcaagctttgagctagcyaygcygagaccggcatcRctatgccatgg aagcttcagacgcggcaactactcccaagtcacccgatc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.