Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 4DL_14421523

[Submit comment/correction]

Sequence	BS00110765_51
Contig	4DL_14421523
Probe	BS00110765_51
DNA Homology	4DL_14421523 Best IWGSC match 159 5e-37 URGI_Best IWGSC_N
BLAST, e-value	5e-37 4DL_14421523 Best IWGSC match
DNA	ctgctcgtggacggtttcggcctggagcccaccaaggaaatcacggtggc Rcagaaggtgaagcatggggagtacttcatcgaagccgcatgggcgctcg g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.