Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3B_10419103

[Submit comment/correction]

Sequence	BobWhite_c15529_288
Contig	3B_10419103
Probe	BobWhite_c15529_288
DNA Homology	3B_10419103 Best IWGSC match 148 1e-33 URGI_Best IWGSC_N
BLAST, e-value	1e-33 3B_10419103 Best IWGSC match
DNA	ccagcagcacgcccctcggcagcgctctccacatcggcatacagccatac Rccacatgggcactactcgacctcaacctatacctagactctatatacat a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.