Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TA002774-0685

[Submit comment/correction]

Sequence	TA002774-0685
Contig	4DS_523211
Probe	TA002774-0685
DNA Homology	4DS_523211 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 4DS_523211 Best IWGSC match
DNA	aatcttgccaccaaagaatgcgagcatgccaactcgggaacaccttttcc Rtga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.