Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 4DL_14426223

[Submit comment/correction]

Sequence	wsnp_BF473052D_Ta_2_1
Contig	4DL_14426223
Probe	wsnp_BF473052D_Ta_2_1
DNA Homology	4DL_14426223 Best IWGSC match 159 4e-37 URGI_Best IWGSC_N
BLAST, e-value	4e-37 4DL_14426223 Best IWGSC match
DNA	ATCAGGGAGAACATCGAGAAGGTATACCAGCAATTTTTTGTGAATTGACC TGCAGTATTTRGTTTCCTGCCATACAATGGCTCTGTTT

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.