Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 4DL_14465231

[Submit comment/correction]

Sequence	TA002331-0702
Contig	4DL_14465231
Probe	TA002331-0702
DNA Homology	4DL_14465231 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 4DL_14465231 Best IWGSC match
DNA	cctgcttcagttggtctgaagccacctgccaagattgaacgcaacaagtc Rttc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.