Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_rep_c67379_241

[Submit comment/correction]

Sequence	BobWhite_rep_c67379_241
Contig	5BS_2277802
Probe	BobWhite_rep_c67379_241
DNA Homology	5BS_2277802 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 5BS_2277802 Best IWGSC match
DNA	tactatgcaaaggtcggcaaggcgtggaagcgcgggtacctcctttatgg Rccgcccggcaccggcaagtccaccatgatcgccgctatggccaacttcc t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.