Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5DS_2501505

[Submit comment/correction]

Sequence	RFL_Contig1466_405
Contig	5DS_2501505
Probe	RFL_Contig1466_405
DNA Homology	5DS_2501505 Best IWGSC match 135 9e-30 URGI_Best IWGSC_N
BLAST, e-value	9e-30 5DS_2501505 Best IWGSC match
DNA	gggctgtcacttccgtggacgacattccttcctgtttgaactgcaagatc Rccccttatggtccctggctcagcttgaagggggttagtagctccgatca g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.