Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5BS_2270357

[Submit comment/correction]

Sequence	Excalibur_c12132_157
Contig	5BS_2270357
Probe	Excalibur_c12132_157
DNA Homology	5BS_2270357 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 5BS_2270357 Best IWGSC match
DNA	gtgcatggaggcgcccaaaacaagacaagttacaagaatggcacagcact Ratatcgacatgctaccaccaactggaactgtgagagagaatgcccaaac a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.