Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Tdurum_contig29342_400

[Submit comment/correction]

Sequence	Tdurum_contig29342_400
Contig	5DS_2759385
Probe	Tdurum_contig29342_400
DNA Homology	5DS_2759385 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 5DS_2759385 Best IWGSC match
DNA	cgagatcccggaggaggctcgtcaccgtgtggcacatgcagcaggagctc Rtgccgaagatcaccaccgcccgctgccccgctagcttcgtcacctgctc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.