Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Tdurum_contig13991_410

[Submit comment/correction]

Sequence	Tdurum_contig13991_410
Contig	6DL_158110
Probe	Tdurum_contig13991_410
DNA Homology	6DL_158110 Best IWGSC match 156 7e-36 URGI_Best IWGSC_N
BLAST, e-value	7e-36 6DL_158110 Best IWGSC match
DNA	actcagcgttcacgaggacgtcactcatgactgccgcagcatgcccagtg Rgctcttcagatggcctcctcaacatgaacatctgtccacggtgagatat c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.