Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig5448_50

[Submit comment/correction]

Sequence	RFL_Contig5448_50
Contig	5DS_272190
Probe	RFL_Contig5448_50
DNA Homology	5DS_272190 Best IWGSC match 145 1e-32 URGI_Best IWGSC_N
BLAST, e-value	1e-32 5DS_272190 Best IWGSC match
DNA	tggagtggggtgcgaatataaaccaagccgagggggctgggccggaaaag Rgctgggagcagactggaggcgcagcgccgagtgtgtgacctcctgagcc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.