Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c43762_349

[Submit comment/correction]

Sequence	RAC875_c43762_349
Contig	5BS_2281622
Probe	RAC875_c43762_349
DNA Homology	5BS_2281622 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 5BS_2281622 Best IWGSC match
DNA	atcttgggctacccatctctctcatgacctgcatcgcacaaattggccct Rtgagcagaatcacctgcatgtcggaatgccaaatatgcaccaaattcag g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.