Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5BS_1324795

[Submit comment/correction]

Sequence	Kukri_c13275_302
Contig	5BS_1324795
Probe	Kukri_c13275_302
DNA Homology	5BS_1324795 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 5BS_1324795 Best IWGSC match
DNA	cattccgtggtacatggtcttctagcaactctctcccccaaaatgcatgc Raagccccctccaccatcagagaacatggctggtggaaccctgaattacg g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.