Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5BS_2289567

[Submit comment/correction]

Sequence	Jagger_c1760_198
Contig	5BS_2289567
Probe	Jagger_c1760_198
DNA Homology	5BS_2289567 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 5BS_2289567 Best IWGSC match
DNA	tcgacggacacaaactccgcggcccctggatgaccaagaggggactttcc Ragtggactcggcttatcagcaaacctcttgtcacggttagccaccggcc g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.