Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c37529_151

[Submit comment/correction]

Sequence	Excalibur_c37529_151
Contig	5DS_2730791
Probe	Excalibur_c37529_151
DNA Homology	5DS_2730791 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 5DS_2730791 Best IWGSC match
DNA	tataagaggtgccggaacattgcttgccagagtgctctcccggctgagga Rtgcagatgcaatgtatgtgctaacagaaatgggttttgcaacctttgca t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.