Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c61307_101

[Submit comment/correction]

Sequence	Excalibur_c61307_101
Contig	4DL_14429928
Probe	Excalibur_c61307_101
DNA Homology	4DL_14429928 Best IWGSC match 156 7e-36 URGI_Best IWGSC_N
BLAST, e-value	7e-36 4DL_14429928 Best IWGSC match
DNA	tgcggtgggcatttcaggaagcggatgctatcaagatcatgccaaaggca Ragcatgccaaagggcgatgctcattcccgttcttagtgagatgggttta c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.