Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: tplb0041f20_300

[Submit comment/correction]

Sequence	tplb0041f20_300
Contig	5DS_2773349
Probe	tplb0041f20_300
DNA Homology	5DS_2773349 Best IWGSC match 182 9.94922e-44 URGI_Best IWGSC_N
BLAST, e-value	9.94922e-44 5DS_2773349 Best IWGSC match
DNA	ggcgggctggccacggagctcgaggcccacggcgccgacctcaacgaccc Rctctggagcgccaagtgcatcctctcctccccgcacctcatccgcaagg t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.