Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-3303_848

[Submit comment/correction]

Sequence	GENE-3303_848
Contig	5DL_4468303
Probe	GENE-3303_848
DNA Homology	5DL_4468303 Best IWGSC match 124 1e-26 URGI_Best IWGSC_N
BLAST, e-value	1e-26 5DL_4468303 Best IWGSC match
DNA	tctgcacaaatgagataagccatgggtcaaataccactgacgaatgggga Ratyayagtytyggtyaagtacagagatctc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.