Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5DL_935631

[Submit comment/correction]

Sequence	Excalibur_rep_c97323_217
Contig	5DL_935631
Probe	Excalibur_rep_c97323_217
DNA Homology	5DL_935631 Best IWGSC match 159 5e-37 URGI_Best IWGSC_N
BLAST, e-value	5e-37 5DL_935631 Best IWGSC match
DNA	cttcttcaagtgcgcttctgcaggtacgtcggcgtggacgaggagacggg Rgcggagctcttctactacttcgtggagtccgagaggagccccgaaacgg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.