Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BS00043532_51

[Submit comment/correction]

Sequence	BS00043532_51
Contig	5DL_4511568
Probe	BS00043532_51
DNA Homology	5DL_4511568 Best IWGSC match 145 1e-32 URGI_Best IWGSC_N
BLAST, e-value	1e-32 5DL_4511568 Best IWGSC match
DNA	gaggctccgggagagggctggcgcgctccgccgcgagaacctcgcgctgc Rtgccaacctgtgcaaggtggtgctaccgccggcagaggctgcccccggc t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.