Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ex_c104539_35

[Submit comment/correction]

Sequence	Ex_c104539_35
Contig	5AL_2786658
Probe	Ex_c104539_35
DNA Homology	5AL_2786658 Best IWGSC match 154 2e-35 URGI_Best IWGSC_N
BLAST, e-value	2e-35 5AL_2786658 Best IWGSC match
DNA	ctactagatggagacgatgcagcagtatgtgactatatttattggtatga Rgagccggagaagggattgttcttctcctctcctc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.