Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5DL_4471433

[Submit comment/correction]

Sequence	wsnp_RFL_Contig44_5147697
Contig	5DL_4471433
Probe	wsnp_RFL_Contig44_5147697
DNA Homology	5DL_4471433 Best IWGSC match 94 2e-17 URGI_Best IWGSC_N
BLAST, e-value	2e-17 5DL_4471433 Best IWGSC match
DNA	aaacttgggggagaatcagaagagagcctagctaatcctaaggctgcatc Mtg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.