Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c52167_355

[Submit comment/correction]

Sequence	Excalibur_c52167_355
Contig	5AL_2772873
Probe	Excalibur_c52167_355
DNA Homology	5AL_2772873 Best IWGSC match 147 4e-33 URGI_Best IWGSC_N
BLAST, e-value	4e-33 5AL_2772873 Best IWGSC match
DNA	ttgtatccctcggcgcgtcagggaccgccatgtccgcaacacgtctgtac Rccgacgattcagcaggatgcagctcttctaccagcagttctgaagcctr g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.