Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c61493_327

[Submit comment/correction]

Sequence	RAC875_c61493_327
Contig	4DS_2312342
Probe	RAC875_c61493_327
DNA Homology	4DS_2312342 Best IWGSC match 122 7e-26 URGI_Best IWGSC_N
BLAST, e-value	7e-26 4DS_2312342 Best IWGSC match
DNA	ctaatggggtagccggcaatgcagtctaagaggattcttctttgcatccc Rtacacttggacggagtgggaggccgccgcagcgatgctggactcggagc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.