Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TA006037-0261

[Submit comment/correction]

Sequence	TA006037-0261
Contig	5AL_2799595
Probe	TA006037-0261
DNA Homology	5AL_2799595 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 5AL_2799595 Best IWGSC match
DNA	aagcaaaggctagcctcttgaaacgcttgttggagtctaaggaacacctg Rcaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.