Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5AL_2768291

[Submit comment/correction]

Sequence	GENE-2725_244
Contig	5AL_2768291
Probe	GENE-2725_244
DNA Homology	5AL_2768291 Best IWGSC match 172 5.99994e-41 URGI_Best IWGSC_N
BLAST, e-value	5.99994e-41 5AL_2768291 Best IWGSC match
DNA	tgaccgacaacatcatatgtggaaaactaaagctagatgcgtgcaactgc Raagtaaaacagaggatgtcatcygaggataagctgcagattcagtg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.