Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c17045_186

[Submit comment/correction]

Sequence	BobWhite_c17045_186
Contig	5AL_2671537
Probe	BobWhite_c17045_186
DNA Homology	5AL_2671537 Best IWGSC match 132 1e-28 URGI_Best IWGSC_N
BLAST, e-value	1e-28 5AL_2671537 Best IWGSC match
DNA	catcccgaacggcacctacgcgctcaccgcgcaggactgcatccagtgcc Rctgcagttcaaacaccttccagctaaactgcaccgccctgcaaggcaag a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.