Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5AL_2801488

[Submit comment/correction]

Sequence	RAC875_c54693_298
Contig	5AL_2801488
Probe	RAC875_c54693_298
DNA Homology	5AL_2801488 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 5AL_2801488 Best IWGSC match
DNA	tctctagagaagatccaagcactatgtctatgatgatcacttttcctccc Rtttctcgggaaggtatggccttcttgcattgagcgaggatcttgatgca a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.