Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Kukri_c13693_87

[Submit comment/correction]

Sequence	Kukri_c13693_87
Contig	5AL_2805189
Probe	Kukri_c13693_87
DNA Homology	5AL_2805189 Best IWGSC match 180 3.9937e-43 URGI_Best IWGSC_N
BLAST, e-value	3.9937e-43 5AL_2805189 Best IWGSC match
DNA	tccgctgcactcttcagatgaatygcaacatggtggagtacagggaagac Rctctgctgaatgtaacaacggccacaaccggggtgatcggtggagtcca a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.