Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_BF201102B_Ta_2_5

[Submit comment/correction]

Sequence	wsnp_BF201102B_Ta_2_5
Contig	5BS_2294415
Probe	wsnp_BF201102B_Ta_2_5
DNA Homology	5BS_2294415 Best IWGSC match 180 3.9937e-43 URGI_Best IWGSC_N
BLAST, e-value	3.9937e-43 5BS_2294415 Best IWGSC match
DNA	ACGTTCACTCGGAAATGAATCTTCGTGTTTCTTTAAAGGTTGTTTGCGTG CTTGTATTGTRTGTCTTATATTATGTGCACTCGCTACTCGTGCAGCTTG

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.