Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5DL_4590136

[Submit comment/correction]

Sequence	BobWhite_rep_c63591_317
Contig	5DL_4590136
Probe	BobWhite_rep_c63591_317
DNA Homology	5DL_4590136 Best IWGSC match 122 7e-26 URGI_Best IWGSC_N
BLAST, e-value	7e-26 5DL_4590136 Best IWGSC match
DNA	ccgctcaccgtcgccagagcagcgggggcctggactgctgcccagacggc Rccgcactgcaacacggaggccagcttctgcagctgcgagctctgggcgg t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.