Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5AL_2758447

[Submit comment/correction]

Sequence	IAAV6174
Contig	5AL_2758447
Probe	IAAV6174
DNA Homology	5AL_2758447 Best IWGSC match 279 0 URGI_Best IWGSC_N
BLAST, e-value	0 5AL_2758447 Best IWGSC match
DNA	cccacgagtgggtccaaatatcatgtgtcagcaagcactgggcaagcatg ttccgaggagaatacttgtggcaaaccgctattgcaaggaaatggccatc Rgctggtttccggaaacgctggcctgggccaattcccagaggctctgcta ggagannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn n

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.