Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3B_10757347

[Submit comment/correction]

Sequence	RAC875_rep_c119031_71
Contig	3B_10757347
Probe	RAC875_rep_c119031_71
DNA Homology	3B_10757347 Best IWGSC match 152 8e-35 URGI_Best IWGSC_N
BLAST, e-value	8e-35 3B_10757347 Best IWGSC match
DNA	tgattcctaatgcatctcagaaataattgtttctggaggaatgaccatgc Macaggtgattaccgcgctagacctgcccttgataagaaccagggaaacc a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.