Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-4139_155

[Submit comment/correction]

Sequence	GENE-4139_155
Contig	5AL_2752420
Probe	GENE-4139_155
DNA Homology	5AL_2752420 Best IWGSC match 158 2e-36 URGI_Best IWGSC_N
BLAST, e-value	2e-36 5AL_2752420 Best IWGSC match
DNA	ggttcagaggcttcttcaacatcaaggagcggacggggcctgcggatgga Rgaaaatgggagccgrccaagagcatcaacctgaagatargca

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.