Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_rep_c108059_176

[Submit comment/correction]

Sequence	Excalibur_rep_c108059_176
Contig	3B_10515787
Probe	Excalibur_rep_c108059_176
DNA Homology	3B_10515787 Best IWGSC match 143 5e-32 URGI_Best IWGSC_N
BLAST, e-value	5e-32 3B_10515787 Best IWGSC match
DNA	gagtgatttcttgtagtaaccaggatacatattccaccaaatcacccttt Rtggtttgcctattgttttgatatgttctcagtttcagttccttacagcc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.