Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5DL_4567798

[Submit comment/correction]

Sequence	IAAV8378
Contig	5DL_4567798
Probe	IAAV8378
DNA Homology	5DL_4567798 Best IWGSC match 150 7e-34 URGI_Best IWGSC_N
BLAST, e-value	7e-34 5DL_4567798 Best IWGSC match
DNA	tggctgggttgcggatgacgtagccatcgaccaaggtatagagatcagac tgcacaagcaacaaatcagatgtagccttcacgggcagaaaccttgagcg Rggaacgttgatgccgattgctttctcaaagannnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn n

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.