Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_c29304_38355434

[Submit comment/correction]

Sequence	wsnp_Ex_c29304_38355434
Contig	5DL_4493313
Probe	wsnp_Ex_c29304_38355434
DNA Homology	5DL_4493313 Best IWGSC match 368 0 URGI_Best IWGSC_N
BLAST, e-value	0 5DL_4493313 Best IWGSC match
DNA	gatcaatcatttgatccacatccatagatgcaacggccttcttgttgctg ctacctggagggggcattaagtcgaagtccatacctctctccctatccct Mtcccattccttctctctgacaaacttccttgctgcttggggtgtactaa aactggacctccgtctttcatccctgccacccaccggcattggaggaagg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.