Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: tplb0021e12_768

[Submit comment/correction]

Sequence	tplb0021e12_768
Contig	5BL_10804947
Probe	tplb0021e12_768
DNA Homology	5BL_10804947 Best IWGSC match 159 5e-37 URGI_Best IWGSC_N
BLAST, e-value	5e-37 5BL_10804947 Best IWGSC match
DNA	tcaacggcgacctcgtcgtcgacgacgccgacatcggctactaagtagct Rccatgcgtgcgtggttggctagtcggtcccaggtcagatgggcagcgga g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.