Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig1548_762547

[Submit comment/correction]

Sequence	wsnp_RFL_Contig1548_762547
Contig	5DL_4488159
Probe	wsnp_RFL_Contig1548_762547
DNA Homology	5DL_4488159 Best IWGSC match 158 2e-36 URGI_Best IWGSC_N
BLAST, e-value	2e-36 5DL_4488159 Best IWGSC match
DNA	aggatcacttctatcagttccaatggcgcccgaggccaccatcactactt Mctcctgagaaggaggaggacatctcaaagaacctcaagcggtacagcaa g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.