Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c14360_420

[Submit comment/correction]

Sequence	BobWhite_c14360_420
Contig	5AL_2802951
Chromosome	5A
Probe	BobWhite_c14360_420
Reference	Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
DNA Homology	5AL_2802951 Best IWGSC match 122 7e-26 URGI_Best IWGSC_N
BLAST, e-value	7e-26 5AL_2802951 Best IWGSC match
DNA	gctgcaataatagagaaagcgaatgccatacgccaggcggtgggaagtga Ygacgaagacgacgataattggagtgacacatagagaacccattattttg c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.