Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Tdurum_contig42305_2439

[Submit comment/correction]

Sequence	Tdurum_contig42305_2439
Contig	5BL_9585222
Probe	Tdurum_contig42305_2439
DNA Homology	5BL_9585222 Best IWGSC match 150 3e-34 URGI_Best IWGSC_N
BLAST, e-value	3e-34 5BL_9585222 Best IWGSC match
DNA	ccgggaccccacgccccagctggagctgatgagaccttggcctggacggc Racgtcgaccatgacgacgccccatgcaaggtctgctgcacaagagaccg c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.