Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c146_92

[Submit comment/correction]

Sequence	Excalibur_c146_92
Contig	5DL_2435171
Probe	Excalibur_c146_92
DNA Homology	5DL_2435171 Best IWGSC match 154 2e-35 URGI_Best IWGSC_N
BLAST, e-value	2e-35 5DL_2435171 Best IWGSC match
DNA	gccgccatcaccaaggtgctggcggaggccgggagcgccaaggcggtggc Rttcgacgagatcgacaaggccccggaggagaaagccagaggaatcacca t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.