Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_rep_c74985_53

[Submit comment/correction]

Sequence	RAC875_rep_c74985_53
Contig	5DS_2781710
Probe	RAC875_rep_c74985_53
DNA Homology	5DS_2781710 Best IWGSC match 148 1e-33 URGI_Best IWGSC_N
BLAST, e-value	1e-33 5DS_2781710 Best IWGSC match
DNA	tcatttggtcactctggaggattcatctgcccgtttgttccgctgctgcc Rgtgatgtgcattctcataaacacatacttgctcataaatctagggggtg g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.