Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IAAV6265

[Submit comment/correction]

Sequence	IAAV6265
Contig	5DL_4505503
Probe	IAAV6265
DNA Homology	5DL_4505503 Best IWGSC match 327 0 URGI_Best IWGSC_N
BLAST, e-value	0 5DL_4505503 Best IWGSC match
DNA	taggaaagttttgcatgcccgaagcacctgaggaaccttgaatgtttccc attccgtttgggaagctgcccattggaggcatattgcctggagggatgga Rcccggatgattctggttcaggccaatcaagtgttgtggcatttgaggca tcatctgggttgacgaaccttgcattgccattgggtgtggcatgggtggt a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.