Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: JD_c48840_530

[Submit comment/correction]

Sequence	JD_c48840_530
Contig	1DS_1895176
Probe	JD_c48840_530
DNA Homology	1DS_1895176 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 1DS_1895176 Best IWGSC match
DNA	atctcgccgatcgtgtacgagtgcctcatcaacccgctcatgcgcggcct Rccgaccaaccaaacggtggtggacgagagcctggagaagctcaagaagg t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.