Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3B_5274783

[Submit comment/correction]

Sequence	RAC875_c8624_539
Contig	3B_5274783
Probe	RAC875_c8624_539
DNA Homology	3B_5274783 Best IWGSC match 135 9e-30 URGI_Best IWGSC_N
BLAST, e-value	9e-30 3B_5274783 Best IWGSC match
DNA	aaccagtcaccctaatgtgcatagaaaagattgaagggtgatgccacaag Raccgatgaggaaatcaaactgagggtatctacggttatcctattgagat c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.